Cortinarius subfoetens

Cortinarius subfoetens M.M. Moser & McKnight, Mycotaxon 55: 310 (1995) [MB#412882]

Phlegmacium subfoetens (M.M. Moser & McKnight) Niskanen & Liimat.

Type: Wyoming, USA

Description

Pileus: 40-152 mm across, glutinous to dry, brown to yellow-brown or greenish sometimes fibrillose or spotted, some with whitish universal veil patches. Margin inrolled into maturity. Flesh firm and compact. Gills: Pale lilac to argillaceous then pallid grey-brown to brown. Flesh: pallid, pale lilac grey, firm and compact. Stipe: 50-121 mm long, 23-40 mm at apex, base bulbous, 24-56 mm across. Spores: mean 7.9 x 4.9 microns. KOH: Dark brown on cap, orange on flesh and stipe (CA collections) while type description records reddish-brown on cuticle and light brown on flesh.UV: Red, yellow on cap surface. Odor: The type description records an odor of green corn but in the recent CA collection was indistinct.

As illustrated by the following sequenced collections, Cortinarius species can ‘brown out’ or ‘bronze out’ appearing very different in age. It is important to have young specimens to be able to see distinctive features.

NS2414 – Cortinarius subfoetens, Sequoia National Forest, California, 2017
NS2341 Cortinarius subfoetens, Yuba Pass, CA. 2017
Copyright Ron Pastorino, Mushroom Observer: 291870 [Link]

Type Description

Cortinarius subfoetens was described by M.M. Moser & McKnight in 1995 based on a single from Grand Teton. In this collecdtion, the lilac colors in young stipe and flesh were not noted.

ITS Analysis

Cortinarius subfoetens is in the section Glaucopodes, newly transferred to genus Phlegmacium, sub-genus Bulbopodium by Liimatainen et al (2022). It is in a sister section to Bulbopodium, Glaucocephela and Cerulea which are well represented in the Pacific Northwest as well as others which I have yet to understand well. See figure below.

Liimatainen et al (2014) shows the placement of Cortinarius subfoetens in the Glaucopus clade:

>NS2414
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATATCTCTCTGAATGCTAGTCACTCAGGTTTGAGGATTGACTTTATGTCTCTCCTTGCATTTCCAGGCCTATGTTTCTTTATATACCCAATGTATGTCATAGAATGTAATCAATGGGCCTTTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAACTTTTGTTTGTCGGGTGTTGGATTTGGGGGTCTTTTTTTGCTGGTCTTGTATCAGCTCCCCTGAAATGCATTAGCAGAACAATTTGTGAATCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAACTTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGTCAGTCTTTGGCTGCCCGAGTTGTAATCTAGAGAAGTGTTATCCGC

>NS2341 Cortinarius subfoetens
TGTTTCTTTATATACCCAATGTATGTCATAGAATGTAATCAATGGGCCTTTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAACTTTTGTTTGTCGGGTGTTGGATTTGGGGGTCTTTTTTTGCTGGTCTTGTATCAGCTCCCCTGAAATGCATTAGCAGAACAATTTGTGAATCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAC

References

K. Liimatainen et al., “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era,” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (December 2014): 98–140, https://doi.org/10.3767/003158514X684681.

Kare Liimatainen et al., “Taming the Beast: A Revised Classification of Cortinariaceae Based on Genomic Data,” Fungal Diversity 112, no. 1 (January 2022): 89–170, https://doi.org/10.1007/s13225-022-00499-9.

M.M. Moser & McKnight, Mycotaxon 55: 310 (1995)

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

%d bloggers like this: