Cortinarius clintonianus

Cortinarius clintonianus Peck (1873)

Description

In young state, Cortinarius clintonianus should be clearly recognizable as an Anomali – it has typical pallid brownish colors on the dry cap and lilac young gills and upper stipe. However, photographed collections show that the lilac phase is not always visible, or may be transient. Gills of young specimens may appear more pallid, greyish or even clay colored.

In stature, it is less slender than some other Anomali species: Stipe may be 50–75 mm long, 4.5–9 mm thick at stipe apex. The stipe has the typical buff to yellowish veil bands on the lower part.

The size and lack of pronounced lilac tones can lead to confusion with Telamonia species. A check of spores should help differentiate from some species. Spores are relatively small (av. 7.5 × 6 μm – subgloboid to broadly ellipsoid) (Dima et al, 2021), a feature necessary to key out the species relative to other conifer associates in this section.

The species is generally collected in fall.

Protolog:

Distribution

Cortinarius clintonianus occurs in mature conifer forests with Pseudotsuga and Tsuga, Pinus and Thuja or Pinus and Abies and sometimes with Populus and Betula. The species has a relatively wide distribution. I have collections from Buck Creek, WA and further South near Packwood, WA. However, the species was described from New York State and the recent Type Paper (Dima et al. 2021) reports Cortinarius clintonianus from Canada: British Columbia & Ontario, USA: New York, Michigan, Minnesota and Washington.

ITS Comparison

The query sequence has one spacer different to the lectotype (MZ580450). However, the lectotype is a relative short sequence of 306 base pairs. However, strong confirmation comes from the fact that one of these collections was cited in the recent Anomali type paper as representative of the species.

>SDA 653 Cortinarius clintonianus

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGGGTTGCTGCTGGTCCTTTAATGGATATGTGCACGCCTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGACAAGTTTCTTAATGCCTAGCATTAAGGTTTTGGGATTGACTTTTGTCTTTCCTTATATTTCCGGGTCTATGTTTATTCATATACCCTAATGTATGTTATAGAATGTAATAAGTGGGCCTTTGTGCCTATAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTTTTCAGCTTTGGCTTGTTGAGTGTTGGATGTGGGGGGCTTTTTTGCTGGTCTTTTAAAGAGGTCAGCTCCCCTAAAATGTATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAATTATCTACGCTATTGACGTGAAGCAGTTCAGCTTCTAACAGTCCATTGGCTTGGACACTTTTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGTCAGTCTTTGGC

References

Dima B, Liimatainen K, Niskanen T, Bojantchev D, Harrower E, Papp V, Nagy LG, Kovács GM, Ammirati JF. 2021. Type studies and fourteen new North American species of Cortinarius section Anomali reveal high continental species diversity. Mycological Progress. 20:1399–1439, doi:10.1007/s11557-021-01738-0.

Peck, C.H. 1873. Descriptions of new species of fungi. Bulletin of the Buffalo Society of Natural Sciences. 1:41-72