Cortinarius nettieae

Cortinarius nettieae Ammirati, C.L. Cripps, Liimat., Niskanen & Dima, Mycological Progress 20 (11): 1427 (2021)

Note: This is a recently described species, named for the late Nettie Laycock. I refer you to the type description until I have time to detail these collections fully.

Description

Photos

Phylogeny

It is worth reading about the phylogenetics of C.nettieae vs others in sub-section Tabularis (of which it is part) for interesting discussion of the way genetics factors into species ID. This species has a low degree of difference to other species in the section but a high degree of consistency (very low intraspecific variation). Indeed, my sequence is an exact match to the type MZ580442.1

>SDA788 Cortinarius nettieae
GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAGTAAACCTGATGGATTGTTGCTGGTTCTTTAATGAACATGTGCACATCTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGACAAGTTTCTTAATCCTAGTATTAAGGTTTTGGGATTGACTTTATTGTCTTTCCTTATATTTCTGGGTCTATGTTTATTCAAATACCCTAATGTATGTTATAGAATGTAATAAGTGGGCCTTTGTGCCTATAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGCTGGATGTGGGGGCTTTTTTGCTGGTCTTTCTAAAGAAGTCAGCTCCCCTAAAATGTATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAATTATCTACGCTATTAACGTGAGGCAGTTCAGCTTCTAACAGTCCATTGACTTGGACAGTTTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGC

Reference:

Dima B. et al., “Type Studies and Fourteen New North American Species of Cortinarius Section Anomali Reveal High Continental Species Diversity,” Mycological Progress 20, no. 11 (November 2021): 1399–1439, https://doi.org/10.1007/s11557-021-01738-0.