Cortinarius rubiginosus

Niskanen, T. & Liimatainen, K. 2021. Nomenclatural novelties. Index Fungorum no. 506

Discussion

Cortinarius rubiginosus has long been referred to as C. rubicundulus in western North America (Siegel & Schwarz 2016, Desjardin et al. 2015), or occasionally as C. pseudobolaris. Cortinarius rubiginosus is a sister species to the European C. rubicundulus, with has a 97.2% similarity in the ITS sequence. An eastern North American collection of C. aff. rubicundulus (NS 2182, SDA 068) differs from C. rubiginosus by 7 base pairs and 5 gaps, and is also 97.2% similar to C. rubicundulus. The best features to identify this mushroom are the creamy-beige to yellowish-beige cap that develops ocher-orange colors, the tan to light brown gills that darken to rusty-orange, rusty orange spores and especially the bright yellow-orange staining, which slowly becoming ocher-red to reddish-orange.

Photos

Description

Cap: 3-9 cm across, rounded to broadly bell-shaped when young, becoming broadly convex to plane and finally irregular and uplifted in age. Creamy-beige to yellowish-beige at first, developing reddish-brown streaks and stains and becoming ocher-brown to orange-brown overall in age. Staining bright yellow-orange, slowly becoming ocher-red to reddish-orange. Surface: dry to slightly slippery, slightly fibrillose, smooth or with reddish appressed fibrils. Gills: Broadly attached, close to subdistant, partial gills numerous. Beige at first, darkening to tan or light brown, developing orangish-browns stains and becoming orangish to rusty-brown as the spores mature. Staining bright yellow-orange, slowly becoming ocher-red to reddish-orange when damaged. Stipe: 4-8 (12) cm long 0.5-2 cm thick, often club-shaped, enlarging downward to a swollen or bulbous lower portion, but often with a tapered rooting base below that. Off-white to creamy-beige at first, developing ocher-orange streaks and discoloration from the base up, becoming all ocher-orange to orange-brown in age. Staining bright yellow-orange, slowly becoming ocher-red to reddish-orange when handled, especially at the base and when young. Surface dry, slightly fibrillose, with a faint, evanescent silky annular zone. Partial Veil: Scant, cortina-like, leaving a annular zone of silky whitish to pale ocher fibrils on the stipe that become rusty-brown with spores. Flesh: Thin to moderately thick, fleshy in cap, fibrous in stipe. Whitish to buff, staining bright yellow-orange, and then slowly becoming ocher-red to reddish-orange.

KOH: No reaction Taste: Not Distinctive. Odor: Not distinctive.

Spore Deposit: Rusty-brown. Spores: 6–7 (–7·5) × 4–4·5 (–5) μm, av. 6·6 × 4·3 μm, Q= 1·55–1·67, Qav.= 1·6 μm, almond-shaped to elliptic, slightly roughened, cheilocystidia and pleurocystidia scattered, 20–25 x 4–5 μm, fusoid-ventricose to fusoid cylindrical.

Ecology:

Solitary, scattered or in small clusters on the ground or mossy forest from the greater San Francisco Bay Area north in coastal forests to at least Cordova, Alaska. Especially common in Sitka Spruce forest in the Pacific Northwest, but also with other conifers and Tanoak.

Phylogeny

The type sequence for this species is OL584184 (yet to be released). The description places the species in Section Crassi while Soop et al. (2019) assign it to a new sister section they call Section Rubicunduli.

SDA_119_ITS Cortinarius rubiginosus
CTGGTTCTCTAGGGAGCATTGTGCATACTTGTCGTTTTATCATTTCTTCACCTGTGCACCTTTTGTAGACTTTTGGATATCTTTCTGATGCTTTTATGCACTCAGTTGTGAAGATTGATGGTTGTCTTTCTTTATATTTCCAGGTCTATGTTCATTATATTTTGACCCCGATGTATATATATGGTGTATATGTATAGGCACAAAGCCTTTTTTTATACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCTCAACCTCACTTTGTTGAGTGCTTGGATGTTGAGGGTTGCTGGGGACTCCTTTGGAAACAGGGGAGGGTCTCAGCTCCTTTCAAATATATTAGGAGAACAATTTGTGGACCTGTTCACTGGTGTGATACATTTATCTGCACTGTTGATGTGGTGAAACAAGTTCTAGTCTTTTGACAAAATTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAACAGAAACTAACAAGGATTCCCCTAGTAACTGCGAG

SDA_160_ITS
GTTGTTGCTGGTTCTCTAGGGAGCATTGTGCATACTTGTCGTTTTATCATTTCTTCACCTGTGCACCTTTTGTAGTCTTTTGGATATCTTTCTGATGCTTTTATGCACTCAGTTGTGAAGATTGATGGTTGTCTTTCTTTATATTTCCAGGTCTATGTTCATTATATTTTGACCCCGATGTATATATATGGTGTATATGTATAGGCACAAAGCCTTTTTTTATACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCTCAACCTCACTTTGTTGAGTGCTTGGATGTTGAGGGTTGCTGGGGACTCCTTTGGAAACAGGGGAGGGTCTCAGCTCCTTTCAAATATATTAGGAGAACAATTTGTGGACCTGTTCACTGGTGTGATACATTTATCTGCACTGTTGATGTGGTGAAACAAGTTCTAGTCTTTTGACAAAATTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAACAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGTCTTTTTGGCTATCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGA

Reference

Desjardin, D.E., Wood, M.G. & Stevens, F.A. (2015). California Mushrooms: The Comprehensive Identification Guide. Timber Press: Portland, OR. 560 p.

Niskanen, T. & Liimatainen, K. (2021). Nomenclatural novelties. Index Fungorum no. 506, (IFF 559321 – Index Fungorum #506)

Siegel, N. & Schwarz, C. (2016). Mushrooms of the Redwood Coast. Ten Speed Press: Berkeley, CA. 601 p.

Soop et al., (2019) “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius ( Agaricales ) with an Emphasis on the Southern Mycota.”