Cortinarius metarius Kauffman, Pap. Mich. Acad. Sci. 1: 137 (1921)
Synonym: Cortinarius barbarorum (Source: Liimatainen et. al. 2014)
Description:
Cap 45-100 mm across, convex to nearly plane, glutinous, golden yellow, aging ochraceus yellow, disc with brownish veil squamules. Gills adnexed, close to crowded, 4-8 mm deep, pale lilac to lilac when young, to lilac gray, developing grayish brown tones when mature. Stipe 75-110 mm long, 14-20 mm thick at apex, equal to abrupt rimmed bulb, 26-42 mm across, dry, appressed-fibrillose, band of yellow glutin on bulb rim. Pale lilac at apex, off-white lower, aging dingy tan. Cortina thick, grayish, soon rusty with spores, leaving an annular band of silky fibrils. Flesh thick (8-14 mm thick at disc), white, discoloring brownish in lower stipe in age. Odor indistinct, Taste mild. KOH orange-brown on cap margin, bay brown on disc, slight brownish on flesh, and stipe, brown on bulb.
Habitat: Mixed conifer forest in WA. Spruce and true fir in AK.
Discussion:
This beautiful vivid yellow-capped phlegmaciod species, has a distinctive stature and wide, abrupt, rimmed bulb. The type description notes a bluish violaceous pellicle (glutin) in young specimens that was not noted here. Also, the KOH reaction was not red as common for a calochroid species.
Cortinarius metarius was named from the Greek word “metarius” – a concept of limits due to it being “exactly halfway between” Cortinarius calochrous and Cortinarius caerulescens (see below). It is in section Calochroid sensu latu.
ITS:
Both collections are a good match to GenBank sequence NR_130229 which is from MICH 10374 ITS region; from TYPE material. NS4576 (WA State) is an almost exact match over 810 base pairs (one ambiguous) while NS1837 from AK has one gap, one ambiguous base and 1 substitution.
>NS4576
AGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAATCTGATAAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCATCTTTGTATCTTCACCTGTGCACCTTTTGTAGACCTGAATATCTCTCTGAATGCTTTATAGCACTCAGGATTGAGAATTGACTTCTTGTCTCTTCTTATTTTTCAGGTCTATGTTTCTTCATATACCCTAATGTATGTTTGTAGAATGTGATTAATGGGCCTTTGTGCCTTTAAATCTTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATTATCAACCTCTTTGGTTGGATGTGGGTTTGCTGGCCTCTTGAGGTCAGCTCTCCTTAAATGCATTAGCGGACAACATTTTGCCAACTGTTCATTGGTGTGATAATTATCTACGCTATTGACGGTGAAGCAAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAGCTTATTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGTGAAAAGCTCAAATTTAAAATCTGATAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGC
North American Cortinarius Collections 