Cortinarius aureofulvus sensu auct.

Cortinarius aureofulvus M.M. Moser, Sydowia 6 (1-4): 154 (1952)

Description:
Pileus: 30-90 mm across, convex, to plano-convex, margin incurved, surface viscid, chrome yellow at margin to chestnut on disc,(Ridegway references: light cadmium, deep chrome, orange buff at margin to mars yellow in disc) darker brown spots of dried glutin sometimes seen on cap center. Gills: Pale sulphur yellow, to olive-yellow, then cinnamon brown (the very white gills on one sequenced collection are unusual). Stipe: 40-90 mm tall, 8-17 mm wide at apex, bulbous with obliquely marginate bulb, pale yellow-green (sulphur yellow, olivaceous yellow). Cortina: Pale yellow, yellow glutinous sheath remnants on stipe base. Flesh: White, dense and firm, streaks of grey behind gills. KOH: Wine red on cap and glutin.

Moser’s 1952 Description:

Discussion:
An olive-yellow Cortinarius with yellow gills, and obliquely marginate bulb, described from Austria. While there are several bright yellow Cortinarius species that occur in conifer forest, for our PNW region consider also Cortinarius metarius, Cortinarius cupreorufus and Cortinarius picea. Cortinarius metarius has brighter yellow tones (less olivaceous), and does not have the orange center of disc. The gills are lilac rather than yellow when young, and KOH is orange brown rather than burgandy. Cortinarius cupreorufus has lilac tones on young gills and bruises red on the bulb / bulb margin. It is also easily identified when dried by the uniform wine-red tone of the exsicata.

Phylogeny:
The type for Cortinarius aureofulvus has not be made publically available but there are sequences for the species used in published and peer-reviewed analyses. This species a very close match to these (Garnica (2016) and Liimatainen (2014). Cortinarius aureofulvus is in section Calochroi sub-section Laeticolores.

Sequence:
>SDA_620 Cortinarius aureofulvus
AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAGTAAACCTGATAAGTTGCTGCTGGTTCTTTTGGGAGCATGTGCACACTTGTCATCTTTATATCTTCACCTGTGCACCTTTTGTAGACCTGAGTATCTCTCTGGATGCTTTTTAGCACTCAGGATTTGAGGATTGACTTTTTTGTCTCTTCTTCACATTTTCAGGTCTATGTTTCTTCATATACCCTATGTATGTTAATAGAATGTCATTAATGGGCCTTTGTGCCTATACAAATTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTTCTTTGGTTGGATGTGGGTTTGCTGGCCTCTTGAGGTCAGCTTTCCTCAAATGCATTAGCGGACAACATTTGCCAACCGTTTATTGGTGTGATAATTATCTACGCTATTGACGTGAAGCAAGGTTCAGCTTCTAAATGTCCATTGACTTGGACAAATTTATTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGYGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTATTATCCGCGCTGG

>NS-AKFF-083-14
AAATTTGAGCTTTTCCCGCTTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCACATTAATAAAATAAATTTGTCCAAGTCAATGGACATTTAGAAGCTGAACCTTGCTTCACGTCAATAGCGTAGATAATTATCACACCAATAAACGGTTGGCAAATGTTGTCCGCTAATGCATTTGAGGAAAGCTGACCTCAAGAGGCCAGCAAACCCACATCCAACCAAAGAAGGTTGATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTAATTTGTATAGGCACAAAGGCCCATTAATGACATTCTATTAACATACATAGGGTATATGAAGAAACATAGACCTGAAAATGTGAAGAAGAGACAAAAAAGTCAATCCTCAAATCCTGAGTGCTAAAAAGCATCCAGAGAGATACTCAGGTCTACAAAAGGTGCACAGGTGAAGATATAAAGATGACAAGTGTGCACATGCTCCCAAAAGAACCAGCAGCAACTTATCAGGTT

References:
Garnica S., Max Emil Schon, and Kessy Abarenkov, “Determining Threshold Values for Barcoding Fungi: Lessons from Cortinarius (Basidiomycota), a Highly Diverse and Widespread Ectomycorrhizal Genus,” FEMS Microbiology Ecology 92, no. 4 (2016).

Liimatainen K. et al., “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era,” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (December 2014): 98–140, https://doi.org/10.3767/003158514X684681.

Moser, M. “Cortinarius Studies III” Sydowia. 6 (1/4):154 pp17-161 (1952)

Ridgway, R. “Color standards and Color Nomenclature” Self-published. Washington DC (1912)