Cortinarius neofurvolaesus

Cortinarius neofurvolaesus Kytöv., Niskanen, Liimatainen & H. Lindstr. (2005)

Description:
Pileus
: 20-70 mm across, convex to plane with persistent umbo, hygrophanous, drying in zones raning from dark-brown to red-brown, disc often remaining darker, surrounded by red-brown zones, spotting and bruising brown in age. Margin pale with floccose veil remants giving white appearance. Gills: Light coffee brown, cinnamon brown to dark reddish brown, adnexed to emarginate, moderately crowded. Stipe: 45-105 mm long, 5-9 mm at apex, silky, white to grayish brown, bruising darker brown where handled. Veil: White, forming floccose annular bands on the stipe. Flesh: Dark reddish brown in cap, marbled grey, brown, yellow-brown and cream in stipe and base. Habitat: Coastal conifer forest with Tsuga heterophylla, Pseudotsuga menziesii and Picea sitchensis

Spores: Kytövuori et al (2005) report spore size 7.7-9.1 x 5.0-5.7 microns based on 56 collections in NW Europe. I have yet to check any NAm collections.

Discussion: Cortinarius neofurvolaesus is a medium to large red-brown to brown species in subgenus Telamonia. It is a close relative to Cortinarius sordidemaculatus (= Cortinarius furvolaesus) and has a similar brown spots or bruising with age. Neither species shows purple tones. Cortinarius neofurvolaesus appears slightly more slender, has lighter red-brown tones and in my observation a more pale and less bulbous stipe.

Phylogeny: Our local species differs from the Swedish holotype of Cortinarius neofurvolaesus [NR_131789] in 4 places – two bases and 2 ambiguous bases. Genbank shows slightly varying collections from AK and BC. Since experts report that Cortinarius neofurvolaesus is commonly found in boreal areas, and there is low intraspecific variation in species in this section, I am not certain that this collection from WA State in North America represents exactly the same species.

Kare Liimatainen et al., “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia,” Fungal Diversity, September 8, 2020, https://doi.org/10.1007/s13225-020-00459-1.

Sequence:
>SDA 662 TGCGGAAGGATCATTATTGAAATAAACCTGATGGGCTGTTGCTGGTTCTCTAGGGGGCATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCCCTCCAGGTCTATGTTGCTTCATTTACCCCCAATGTATGTTGATAGAATGTCGTGACTATATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCACTCTTCTTGAGTGGCTTGGATGTGGGGGGTTTGCTGGCCTGTTCAGCTCCCCTGAAATGCATTAGCGGAACGACCTGTTCATTCATTGGTGTGATAACTATCTACGCTATTGAGTGCGAGGCGGTTCAGCTTCCTAACGGTCCTCGGACAGTTTTTATCATTTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTTGGCT

References:

Kytövuori, Ilkka, Tuula Niskanen, Kare Liimatainen, and Håkan Lindström. “Cortinarius Sordidemaculatus and Two New Related Species, C. Anisatus and C. Neofurvolaesus, in Fennoscandia (Basidiomycota, Agaricales).” Karstenia 45, no. 1 (2005): 33–49. https://doi.org/10.29203/ka.2005.402.

Liimatainen, Kare, Tuula Niskanen, Bálint Dima, Joseph F. Ammirati, Paul M. Kirk, and Ilkka Kytövuori. “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia.” Fungal Diversity, September 8, 2020. https://doi.org/10.1007/s13225-020-00459-1.

One thought on “Cortinarius neofurvolaesus”

Add yours

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑