Cortinarius sordidemaculatus

Cortinarius sordidemaculatus, Henry, R. 1981. Les Cortinaires. Bulletin de la Société Mycologique de France. 97(3):157-279

Description:
Pileus: 30-55 mm across, convex to plano-convex, disc occasionally umbonate when young, plane or depressed in age, hygrophanous, grey-brown to dark-brown, darker on disc, tan to yellow-brown when drying (sometimes in concentric bands), finely fibrillose and silky, with pale cortina remnants near margins, large black spots and markings in age or when bruised. Gills: Strongly emarginate (notched) and seceding in age, grey-brown to chocolate brown. Stipe: 70-110 mm long, 6-11 mm at apex, clavate to slightly bulbous, dingy brown to light brown with distinct annular sheath of pale floccose veil tissue or chevrons of material on lower half, darkening when handled. Cortina: Pale grey-brown. Flesh: Brown and cream striations, often tunneled dark-brown by larvae. Habitat: Coastal PNW, mixed conifer forest, Picea, Tsuga heterophylla, Pseudotsuga menziesii (European collections noted a Picea association).

Section:
As shown in the following phylogeny, the species is in section Bovini, subsect. Furvolaesi. This section is characterized by medium to large dark brown species of Telamonia, which bruise dark brown with age and/or handling.

Discussion:

Liimatainen et al (2020)

Discussion:
Cortinarius sordidemaculatus means “dirty / sordid” “spotted”. It is recognized by the fibrilose dark brown cap, medium size, lack of violet tones with dark black-brown spots and bruising.

This species is one of the ‘brown’ hygrophanous Cortiniarius that most field identifiers have lumped together as “/Telamonia s.l.“. A recent paper based on extensive analysis and sequencing of types shows that there are over 800 known species in this “subgenus” and gives us a chance to understand these species better, and name them with more confidence. At first, Telamoniod species may appear similarly “brown” but on closer observation there are clear differences in hue, stature, size, degree of veil, structure of pileus, odor and habitat. I look forward to learning and sharing more species in

Phylogeny:
The type for C.sordidemaculatus is DQ139984 (EU) – this collection is 3-4 base pairs different (647/650 in one comparison) to other EU collections. It is more closely related to TN11-450 (NAm).

Including local collections, my rough phlogenetic analysis of ITS sequences shows some genetic variation. Further morphological and ecological study is needed to see whether or not these are different species. [Note: this analysis was done simply to group species and should not be used to infer strength of relationships.]

Grouping of recent PNW barcodes along with other published sequences from type papers and Genbank

>ITS SDA663
ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGCTCTTTAGGGAGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCCCTCCAGGTCTATGTCGCTTCATTTACCCCCAATGTATGTTGATAGAATGTCATGGAAAAAATATATATATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCACTCTTCTTGAGAGTGGTTTGGATGTGGGGGGTTTGCTGGCCTTTATGAAGGTTCAGCTCCCCTGAAATGCATTAGCAGAACAACCTGTTCATTCATTGGTGTGATAACTATCTACGCTACTGAGTGCGAGGCAGTTCAGCTTCCTAATCGTCCTTGGACAATTTATCATTTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTTGGCTGTCCGAGT

References

Kytövuori, Ilkka, Tuula Niskanen, Kare Liimatainen, and Håkan Lindström. “Cortinarius Sordidemaculatus and Two New Related Species, C. Anisatus and C. Neofurvolaesus, in Fennoscandia (Basidiomycota, Agaricales).” Karstenia 45, no. 1 (2005): 33–49.

Liimatainen, Kare, Tuula Niskanen, Bálint Dima, Joseph F. Ammirati, Paul M. Kirk, and Ilkka Kytövuori. “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia.” Fungal Diversity, September 8, 2020.


:

One thought on “Cortinarius sordidemaculatus”

Add yours

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑