Cortinarius trappei

Cortinarius trappei – Ammirati, Liimat. & Niskanen 2014

Description:
Pileus: 15-35 mm across, convex, sub-umbonate to umbonate, margin straight to inrolled when young, surface moist to dry, burgandy to red-brown, or dull tan when dry, typically covered with fine, appressed bronze (pale orange-brown) veil remnants. Gills: Close, burgandy to rich wine-red, becoming dark brown in age. Stipe: 25-41 mm long, 3-6 mm wide at apex, clavate, longitudinally fribrillose with orange-brown veil tissue when young, later buff, ochraceous buff, reddish towards apex and yellow on base, bruising red-brown where handled. Flesh: Burgandy in cap, stipe buff to red-brown or watery red when mature, dark brown in stipe base. KOH: Dark wine-red on cap and stipe. UV: Not tested on fresh specimens, negative on exsicata. Spores: In the range of the type description (7.4-8.5 x 4.1-5.2)

Habitat: Mixed conifer forest, possibly only in higher elevations of the Cascade Range.

Discussion:

In the past decade, we have come a long way in our understanding of the many different red Cortinarius in our region. This has led to several new red-gilled and all red Dermocybe in the Western USA, (Cortinarius trappei, C. neosanguineus, C. birkebakii, C. rufosanguineus, etc).
Cortinarius trappei is known only from the Western USA (BC, WA), it is superficially most similar to C. smithii, but the orange/ochre universal veil, smaller stature, less yellow stipe and more red-brown to tan cap are differentiating. Cortinarius rufosanguineus shares a similar habitat with C. trappei, but differs by the deep blood red to carmine red fruit bodies when young, and has orange basal mycelium on the stipe.

Phylogeny:

In subgenus Dermocybe, this collection is highly similar to the ITS barcode U56042 which is the Type collection of C. trappei from Easy Pass, Chelan Co. WA. My collections are from the North Cascades and are 99.55% similar (667/670 BP) with changes in two regions. A rough phylogenetic grouping of Dermocybe suggests that while this species has red gills it is not in /Sanguinei. Instead (based a rough grouping) it appears most closely related to C. marylandesis (more analysis is needed as I do not have the type references for many Dermocybe and there is still a lack of clarity around species (e.g. C. marylandensis, C. ominosus, C. semisanguineus etc).

Sequence:

>SDA739 C. trappei
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAATCTGATGGGTTGCTGCTGGCTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATTTCCACCTGTGCACCTTTTGTAGATCTGGATATCTTTCTGAATGCCTGGCATTCAGGTTTGAGGATTGACTTTTGTCTTTCCTTACATTTCCAGGCCTATGTTTTCTTCATATACACCATGTATGTTATAGAATGTAATAAACAGGGCCTTTGTGCCTACAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAGGTTTTTACTTGTTGAGTGTTTGGATGTGGGGGTATTTTTTTGTTGGTCTCTTTTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGCGAAGCAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

References:

Jacques Landry, Yves Lamoureux, and Renée Lebeuf, “Répertoire des cortinaires du Québec,” n.d., 266.

Tuula Niskanen et al., “Cortinarius Section Sanguinei in North America,” Mycologia 105, no. 2 (2013): 344–56.

Tuula Niskanen et al., “Cortinarius Sanguineus and Equally Red Species in Europe with an Emphasis on Northern European Material,” Mycologia 104, no. 1 (January 2012): 242–53, https://doi.org/10.3852/11-137.

2 thoughts on “Cortinarius trappei”

Add yours

    1. There are several for Cortinarius – Funga Nordica is one I recommend. However, it is a large and complex Genus and the phylogeny is only recently being stabilized. The big sub-sections were updated last year so most keys are very out of date. When I reach 100 species on his site I will start to provide some groupings.

      Like

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑