Cortinarius pitkinensis

Cortinarius pitkinensis Ammirati, Liimat. & Niskanen (2014) Index Fungorum 197

Description:

Pileus: 20-60mm across, umbonate with fulvous tan surface streaked with darker brown on disc and lighter yellow-brown on margin. Gills: yellow when young, becoming orange to ochraceous buff, sometimes with darker spots in age. Stipe: 50-90 mm long, 3-8mm wide at apex, equal to slightly clavate, pale yellow to ochre with slightly brassy appearance, bruising dark red at stipe base when handled. Stipe flesh: light yellow near surface, rich yellow in stipe context with olive yellow to yellow brown at base. Basal mycelium: Pale yellow to olive buff. KOH: Bright red on stipe and red on cap.

Habitat: The type location and the location of my collection were both relatively high elevation (8,000 ft in CO, 5,500 ft in WA) meadows among mosses, in a boggy drainage. Both were collected in late summer (late August, very early September).

Discussion:

Cortinarius pitkinensis is a Dermocybe with yellow-to-orange gills that is likely to be misidentified as Cortinarius croceus or Cortinarius cinnamomeus – the most widely known names for yellow and orange-gilled Dermocybe. As it happens, there are many similar species which are challenging to differentiate. It is important to learn to observe in more detail – including habitat, elevation if we are to better discriminate among these species. One feature that is of use with Dermocybe that beginners may not note is the color of the stipe flesh and the color of the basal mycelium. Different species have different degrees of red, orange, olive or black tones in the flesh, and basal mycelium color may also vary. It is helpful to capture this information in photographs and field notes.

I have not seen a detailed comparison of Cortinarius croceus or cinnamomeus and pitkinensis but the effort is likely pointless since there are numerous Dermocybe on the spectrum from olive-yellow, to citron, to ochre and we do not yet have good records of confirmed collections. Superficial observation of my sequenced collections suggests a more acid yellow tone in the young gills and cap of Cortinarius croceus. In the Puget Sound region it is more often collected with Pinus on the East side (I have two confirmed collections), has a shorter stipe, and a different cap color.

I am interested to do more late summer collecting at elevation to explore subalpine drainage areas for related Cortinarius species.

Sequence:
>SDA524 C. pitkinensis WA State
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGCTCTCTCGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATATCTTTCTGAATGCCTGGCATTCGGGTTTGAGGATTGACTTCTGTCTTTTCCTTACATTTCCAGGCCTATGTTTTCTTCATATACACTATTTATGTTATAGAATGTAATGAAAGGGCCTTTGTGCCTACAAACCTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCCTCAGGTTTTGACTTGTCGAGTGTTTGGATGTGGGGGTCTTTTGCTGGTCTCTTTTGAGGTCGGCTTCCCTAAAATGCATTAGCGGAACAATTTGTTGACCCGTTCATTGGTGTGATAACTATCTACGCTTTTGACGTGAAACAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAATTTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Hotoltype KP087982.1