Cortinarius fructuodorus

Cortinarius fructuodorus Niskanen, Liimat. & Ammirati, Botany 91: 483 (2013)

Description:

Pileus: 40-90 mm across, dry, convex to plane with a broad umbo, slightly hygrophanous, mottled pale grey-brown to light brown with darker watery streaks and darker brown tones towards margin when wet. Gills: Light cinnamon-brown to vinaceous-brown in young specimen. Stipe: 55-95 mm long, 12-15 mm at apex, clavate, whitish at first, later streaked light brown, copious white veil remnants may sheath the lower half. Flesh: mottled light brown and cream, vinaceous brown tones in young specimen. Odor: Fruity, pear-like, similar to Cortinarius traganus.

Habitat:

Cortinarius fructuodorus is a Telamonia described from the Pacific Northwest in 2013 (Liimatainen et al. 2020). It occurs in conifer forests in Washington State – with Tsuga and Pseudotsuga (one closely related collection was made in CA). In WA, Cortinarius fructuodorus fruits in fall; October at higher elevations, into November around Puget Sound.

Discussion:

Cortinarius fructuodorus is best recognized by the Cortinarius traganus-like fruity pear odor for which it is named, overall brown (or slightly purple-brown tones) and spores in the range of 8.5-10 x 5.0-6.0 microns. This species is one of several larger pale Telamonia in our region which need further study.

• 

• 

• 

Phylogeny:

The sequence is one base pair match to the HOLOTYPE NR131827, and almost identical to KC608582 discussed in the paper (Niskanen, Liimatainen, and Ammirati 2013). It is highly similar to a CA collection which has two distinct base differences (MT935066.1). The species description reports that C.fructuodorus has three intragenomic polymorphism sites which could be examined for better comparison.

>SDA781 C.fructuodorus
GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTTACAGGTCTATGTTGCCTTTTCATTTACACCAATGTATGTTAATAGAATGTTGTGACTATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATATCAACCCTCTTTTGTTGAGTGGTTTGGATGTGAGGATTTGCTGGATTCTTAAAAGGGTTCCAGCTTCCTTGAAATGCATTAGCAGAACGGACCTGTTCATTGGTGTGATAACTATCAGCGCTATTGAATGTAAGGGTTAGTTCAGCTTTCTAACAGTCCTTGGACAATTAATCATTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGAC

References:

Niskanen, Tuula, Kare Liimatainen, and Joseph F. Ammirati, “Five New Telamonia Species ( Cortinarius , Agaricales) from Western North America,” Botany 91, no. 7 (July 2013): 478–85, https://doi.org/10.1139/cjb-2012-0292.

Kare Liimatainen et al., “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia,” Fungal Diversity, September 8, 2020, https://doi.org/10.1007/s13225-020-00459-1.