Cortinarius armeniacus

Cortinarius armeniacus (Schaeff.) Fr., Epicrisis Systematis Mycologici: 304 (1838)

DESCRIPTION

PILEUS: 35-55 mm diam., convex to broadly convex with flattened umbo, margin long inrolled, and sometimes undulating or folded, margin fine. Hygrophanous, yellow-brown, apricot, chestnut-brown, margin a distinct white line.  Surface glabrous, slightly shiny, generally dry to tacky. GILLS: Adnexed, crowded to medium spaced, light yellow-brown to cinnamon-brown,  STIPE: 45-55 mm long, 8-10 mm thick at apex, equal to clavate. White to buff, fibrillose, vertically streaked with whitish veil material, which is removed when handled. VEIL: White, cortina sparse  FLESH: Firm, white, mottled white, lilac and buff when moist, pale lilac tones in stipe apex, buff to yellow-brown cap context. ODOR: None  TASTE: Mild KOH:

ECOLOGY: Scattered to clustered in conifer forest with Pseudotsuga, Tsuga, Abies sp. and Larix.  Found fruiting in fall.

TYPE DESCRIPTION:

AGARICUS Armeniacus. The apricot-colored agaric. Tom. I. Tab. 81. Caulescent, agaricus, alone and in cespitosus, a little fleshy; the convexity of the cap, obsolete, golden; Lamella when fresh has pale flesh; petiole smooth, sturdy, white, yellow-striped, tuberous base; surface fibrillose; no ring. In forests and pastures found late summer and autumn

DISCUSSION:

Cortinarius armeniacus is not often collected in our region, but is likely overlooked due to inconspicuous colors and general neglect of Cortinarius species. It can be recognized by the smooth to shiny, hygrophanous yellow to chestnut-brown cap with white margin, firm whitish-drab stipe and convex cap with low umbo. Reviewing images of collections identified as Cortinarius armeniacus (e.g. on Mycoportal and iNaturalist) it seems that the species is commonly confused with species in section Lanigeri. These species do not have a smooth and shiny cap surface and have distinctively bright orange gills. Another mistake is made with species in section Vibratiles which may also have a whitish stipe and whitish cap margin. These species can be eliminated by tasting for a bitter cap cuticle.

Cortinarius armeniacus as described by Niskanen in Funga Nordica (Knudsen et al 2018) can be significantly larger than this collection (up to 85 mm in diameter and 120 mm stipe length).

Sequence:

This collection matches the ITS region of DQ117925.1 which was published as an epitype in Kytövuori et al. 2005. Liimatainen et al. 2020 Figure 1 (below) places Cortinarius armeniacus in Telamonia section Firmiores and gives Cortinarius privignus as a synonym.

>SDA_611 Cortinarius armeniacus
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACGCCTTCAGGTCTATCTTGCTTTTTCATTTACCCCAATGTATGTTAATAGAATGTTGTGACTATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCTTCTCTTTACTGAGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTATATGAGTTCAGCTCCCCTGAAATGCATTAGCAGAACAACCCGTTCGTTGGCGTGATAACTATCTACGCTATTGAATGTGAGGGACAGTTCGGCTTTCTAACAGTCCTTGGACAACTTATCATTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCG

REFERENCES:

Knudsen, H.; Jan Vesterholt; Tuula Niskanen; Ilkka Kytövuori; Gyđa Guđriđur Eyólfsdóttir; Katriina Bendiksen; Stig Jacobsson; Arne Aaronsen, Funga Nordica: Agaricoid, boletoid, clavarois, Funga Nordica Agaricoid, boletoid, clavarois, cyphelloid and gastroid genera, Copenhagen Nordsvamp Second Revised Edition, page 870, 2018.

Kytovuori,I., Niskanen,T., Liimatainen,K. and Lindstrom,H.K. Cortinarius sordidemaculatus and two new related species, C.anisatus and C. neofurvolaesus, in Fennoscandia (Basidiomycota, Agaricales), Karstenia 45 (1), 33-50, 2005.

Liimatainen, K. et al., “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia,” Fungal Diversity, September 8, 2020.

Schaeff, Fungorum qui in Bavaria et Palatinatu circa Ratisbonam nascuntur Icones 4: 35, t. 81 (1774)