Cortinarius aff subtortus

Fungi in the Cortinarius subtortus group are relatively easy to recognize due to the olive-brown color of the young gills and bitter flesh. However, they may be hard to separate from the similarly olive-toned and bitter Cortinarius infractus. Funga Nordica suggests differentiating by an odor of cedar and presence of cheilocystidia and pleurocystidia in Cortinarius subtortus, both of which are absent in C.infractus. However we cannot confirm this in our collection.

Within the Cortinarius subtortus group, there appear to be at least three North American species. Mycoquebec records two species among their Cortinarius collections – one matching the Fries (type) concept of Cortinarius subtortus and one hypothesized to match Peck’s Cortinarius glutinosus. This species matches neither, but is the same as a (third) species in this group which has been collected in BC.

Cortinarius aff subtortus, Kenai, AK

Description: Pileus 25 – 83 mm wide, grey-green to tan, grey more pronounced in young specimens. Stipe: 46 – 80 mm long, 5 – 13 mm wide at stipe apex, creamy white with slight grey tone, clavate to bulbous in young specimens but without abrupt bulb. Flesh: Cream in stipe base and more blue-grey in upper stip and cap context when young, fading to yellow-ochre when older, grey tones persist. Taste: Flesh strongly bitter, cap cuticle mildly bitter. KOH: Brown. Habitat – in Spruce with Aspen, BC and AK.

Section: Soop et. al (2019) places this species in section Subtorti.

Sequence:
>SDA_300 Cortinarius aff subtortus
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGTTCTCTAGGGAACATCTGTGCACACCTGTCATCTTTATATCTCTCCACCTGTGCACCTTTTGTAGACCTAGATATCTTTCTGACTGCGCTAGCATTCAGGTTTGAGGATTGATTTTTCCTAGTCTCTCCTTACATTTCCAGGTCTATGTTTTTATATACCCCCCACATCTATTGTATTAGAATGTAATAAATTGGGTCTTTTATGGCCTATAAAATTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATTATCAACTTCATCAACCTTGTTGAATGATTGTTGGATGGTGGGGGTTGTTGTTGGCCTTTTGAAAGAAAAAGGTCAACTCCCCTAAAATCTATTAGCAGAACATTTTGGTTGACCATTTGCTGGTGTGATAACTATCTACGCTATTGATAATGAGGCCAAGTTCAGCTTCTAGCAGCCCATTAAGTTGGACATTTTTTATTATTGATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGTCTTTGACTGTCCGAGTTGTAATCTAGAGAGGTGTTT

Reference:
H.Knudson and Vesterholt, J. (Eds) Funga Nordica (2018)
K. Soop et al., “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius ( Agaricales ) with an Emphasis on the Southern Mycota,” Persoonia – Molecular Phylogeny and Evolution of Fungi 42, no. 1 (July 19, 2019): 261–90

2 thoughts on “Cortinarius aff subtortus”

Add yours

  1. I never saw glutinosus/subtortus with a “so pallid lilac-violet” color in young gills. The “complex” is growing actually in QC, with very young gills already dark olive or more rarely very deep violet then quickly olive.

    Liked by 1 person

    1. Thank you for your comment. I am relatively new to this species complex so your observations are valuable.

      In my collection notes I did not record any lilac in the gills (even pallid). The notes say “Grey green and tan when young, to warmer brown / tan when mature” – so the photograph may be slightly misleading.

      Dimitar placed my collection close to Cortinarius subtortus but in a different ‘clade’. It is bitter and shares similar features (I will do microscopy today). However, it is only approx 99% match to your ‘C.glutinosus’ sequence.

      Like

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑