Ammirati & M.M. Moser, Mycotaxon 72: 296 (1999)
One of the cool things about collecting mushrooms is that many species do not fruit every year, providing the opportunity for surprises. In the spring of 2020, we had several reports of a large, gregarious, purple Cortinarius which had not been recorded before. I was able to sequence one of these collections and it matches the type of Cortinarius citriolens. Keep an eye out for this distinctive species if you are out in the PNW in early summer.
What is Cortinarius citriolens?
Cortinarius citriolens is a large, gregarious Phlegmaciod species with purple cap, lavendar gills and a fragrance of citrus. The species was described by Moser and Ammirati in 1999, from collections in Wyoming USA. It has been confirmed from Quebec, Finland and Sweden. The name refers to the “strong fragrant odor of lemons or lemon pelargonium” (citri-olens = citrus-smell).
Phylogenetics:
This collection is match (one base variation) to the type NR_130208.1.
Description: Pileus 50 – 170 mm across, incurved then convex to plane, lavendar speckled with violet, fading to grayish lavendar or buff. Lamellae: deep lavendar to lavendar grey when young, becoming disclorued buff to cinnamon, with violet shades only visible at gill margins. Stipe: 50 – 90 mm long, 25 – 50 mm thick at stipe apex, clavate to bulbous (without marginate bulb), baswhitish in upper stipe but lilac below cortina, base sometimes yellowish to ochaceous yellow. Veil: White to pale lavendar. Context: white to cream with bluish lavendar in upper stipe cortex and below gills. Habit: highly gregarious and abundant in select locations. Notably early season for a Phlegmaciod (June in PNW, July in Quebec and August in Wyoming). Odor: Sweetish citrus / lemon fragrance, described by Moser and Ammirati as “lemon pelargonium”.
Phylogeny:
>SDA_730 Cortinarius citriolens
TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAATCTGATGAGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACGCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATCTCTCTCTGAATGCTAGCCACTCAGGCTTGAGGATTGACTTTAATGTCTATCCTTACATTTCCAGGCCTATGTTTCTTCATATACTCAATGTATGTCATAGAATGTAATCAATGGGCCTTGTGCCTATAAACATATACAACTTTCAGCAACGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGTTGGATGTGGGGGTCTTTTTTGCTGGTCTTCTCAGATCAGCTCCCCTGAAATACATTAGCGGAACAATTTGTAGACCGTTCATTGGTGTGATAATTATCTACGCTATTGACGTGAAACAGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA
North American Observations:
[With thanks to collectors who shared material and locations after reporting their finds on Facebook]
C.Ambrose, Near Detroit, OR, USA – June 21, 2020
J. Claire, Detroit Lake, OR – June 20, 2020, USA – [SDA 730 Sequenced]
J.Lane, Bethel Ridge Rimrock, WA, USA – June 13, 2020
R. Lebeuf, Gaspe Penninsula, Quebec, CA July 2011
M.Moser and J.Ammirati, Flagstaff Creek, Teton National Forest, WY, USA August 1997 (Holotype)
M.Moser, Lost Lake, Togwotee Pass, WY USA, September 1997
C.Wright, Rimrock, WA (iNaturalist Observation with additional images)
References:
K. Liimatainen et al., “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era,” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (2014): 98–140, https://doi.org/10.3767/003158514X684681.
Moser MM, Ammirati JF. Studies in North American Cortinarii V. New and interesting Phlegmacia from Wyoming and the Pacific North West Mycotaxon. 72 (1997): 289-321.
North American Cortinarius Collections 
Leave a Reply