Cortinarius alboglobosus

Cortinarius alboglobosus Kytöv., Liimat., Niskanen & Ammirati, Index Fungorum 186: 1

Description:
Cap 35 – 110 mm across, convex to broadly convex, dry, at first white and finely fibrillose with with pinkish-ochre tones, becoming buff then pale ochre to pale brown, often with cracks and scales forming, gills light clay colored to tan and cinnamon brown, stipe: 50 – 90 mm long, 12 – 25 mm wide at apex, stout, equal to clavate or ventricose, smoth, creamy white covered with abundant white cortina, flesh: creamy buff to pale brown, sometimes speckled, odor: nil to slightly fruity.

• 

• 

• 

• 

Discussion:
Cortinarius alboglobosus is a telamoniod species in section Niveoglobosi (Telamoniod). The type notes that the European collections were made in mesic birch forest, while PNW collections came from mixed coniferous forest (Tsuga heterophylla, Abies and Picea engelmanii). Comparing local specimens to those pictured from Europe, and the NE, the PNW specimens have more pale brown tones at all stages. Also, the type description did not note cracking on the cap which appears very commonly in our collections.

ITS:
All collections – SDA_111, NS3355, NS3330 and SDA_488 are a close match to Holotype: GenBank no. KM273093. There are a few gaps (by edited segments) and some ambiguous bases (S, W) but are otherwise identical to the type. In the description it is noted that the West Coast specimens vary by an indel and gap. This sequence KM273100 was made at Easy Pass Trailhead, in similar habitat to those shown above, and is identical.
>NS_3355_ITS
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATAGGGTTGCTGCTGGCTCTCTAGGGAGCATGTGCACACCTTGTCATCTTTACATCTCCACCTGTGCACCTTTTGTAGACCTCTCCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTGCATTTATAATGAAACCTATACAACTTTCAGCAACGGATCTCTTGGSTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAAACCCTCTTGTTGAGTGGTTTGGATGTGGAGGGTTTTGCTGGCCTTTTTTTAATGGGTTCAGCTCCTCTAAAATACATTAGCAGAACAACCTGTTCATTCATTGGTGTGATAACTATCTTACGCTGTTGAATGTGAGGCAGTTCAGCTTTCTAACGGTCCTTGGACAACTTATCATTTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCTGGCTGTCCGAG