Cortinarius leucophanes

 Cortinarius leucophanes P. Karst., Meddelanden af Societas pro Fauna et Flora Fennica 6: 3 (1881)

Description
Cap 12-40 mm across, viscid, cream to white with yellow-ocher disc, slight grey to tan concentric pattern, cortina white, gills pallid, stipe: 23-56 mm long, 4-8 mm thick at apex, flesh off-white, becoming orange-brown, odor and taste indistinct, KOH pale grey to no rxn.

In 2019 this species was placed in Section Lustrati by Ammirati ex Soop, Oertel and Dima. The section contains several medium to small, paler, viscid species from North and Central America and Europe. From the PNW it includes Cortinarius oregonensis A.H.Sm. and several closely related species.

SDA 312: Kenai Penninsula, AK. Spruce forest

ITS Analysis
The collections is identical to sequence KJ421083.1 published by Garnica, Riess, Ammirati et al (2014) as C.leucophanes and included in subsequent papers including the 2016 Barcoding paper.]

>SDA_312_Cortinarius_leucophanes
TTTAGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTTTGTGCACATTTTGTAGGCCTGAATATCTTTCTGAGTTGTTAGCGACTCAGGTTTGAGGATTGATTTTAAATAATCTTTCTTTACATTTGCAGGCCTATGTTTCTTTATATATACCCCATTGTATGTTCTAGAATGTAATAAAATGGGCCTTTGTGCCTATAAACATTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAATCTTTGGCTTGTTGAGTGTTGGATGTGGGTTTGCTGGTTTCTCTCTTGAGGTCAGCTCCCCTGAAATGCATTAGCTGAACAATTTGTGGACCTTGTTCATTGGTGTGATAATTATCTACGCTACTGACAACAAAGCAAGCTCAGCTTCTAACAGTCCATTGACTTGGACAATGTTTATATCAAATGTGCCTCAAATCAGGT

References

Sigisfredo Garnica, Max Emil Schon, and Kessy Abarenkov, “Determining Threshold Values for Barcoding Fungi: Lessons from Cortinarius (Basidiomycota), a Highly Diverse and Widespread Ectomycorrhizal Genus,” FEMS Microbiology Ecology 92, no. 4 (2016).

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

%d bloggers like this: