Cortinarius rufoallutus

Cortinarius rufoallutus ((Rob. Henry ex Bidaud & Reumaux), Atlas des Cortinaires 16: 1095 (2006)

Collection Description (NS3391) – USA Washington State:
Cap
35-89 mm across, with a grayish bloom when young, rugose, more orange and thinly viscid in age, stipe 39-65 mm long, 12-15 mm thick at apex, base slightly bulbous with a short abrupt top, flesh creamy beige, odor and taste indistinct, KOH dark brown on cap and stipe, no reaction on flesh.

ITS is a close match to the TYPE, with one base pair and one space difference.
>S3391_Cortinarius_rufoallutus
GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACTGACAGGTTGTTGCTGGTTCTCTAGGGAACATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATATCTCTCTGAGTGCTTGCGCTCAGGTTTGAGGATTGACTTTTGTCTCTCCTTACATTTCCAGGCCTATGTTTCTTCATATACCCTRATGTATGTTATAGAATGTAACAAATGGGCCTCTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATAATCAACCTCTTCAGCTTTTGCTTAACGAGTGTTGGATGTGGGGGAATTTTTTTTGCTGGCCTCTCTGAGGTCAGCTCCCCTGAAATGTATTAGCGGAATAATTTGTGGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAATTCTGCTTCTAATAGTCCATTGACTTGGACAAATTTCATTGACTTGACCTCAAATCAGG

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

%d bloggers like this: