Cortinarius substriatus

Cortinarius substriatus Kauffman, North American Flora 10 (5): 307 (1932)
Collection(s) sequenced: SDA 393 – Pierce County, WA. October 2019; SDA 05B Vancouver Island, October 2016. Shannon Adams

Description:

Pileus: 38-52 mm across, conic, conic-campanulate to convex, viscid to dry, brown to vinaceous grey-brown, when dry – coated with fine whitish innate fibrils, white cap margin. Stipe: 60-86 mm long, 9-12 mm wide at apex, clavate or ventricose, somewhat uneven, , sheathed with white veil, grey tones at stipe apex. Flesh: White, stuffed with less dense spongy tissue. Lamellae: Pallid at first, then light cinnamon to cinnamon brown. Cortina: Abundant, white, abundant. KOH: Dark brown on cap, hyaline on stipe. Habitat: Mixed conifer forest of hemlock, Douglas fir and true fir.

As described in: Kauffman, C.H: North American Flora (1932)

“Cortinarius substriatus C.H. Kauffman sp.nov
Pileus subfleshy, broadly conic-campanulate, 3-7cm broad, surface viscid, glabrous, at first Natal-brown (R), becoming Mikado-brown (R) with a slight purplish tint, fading, striate at times on the thin margin; lamellae adnate, rounded behind, moderately broad, ventricose, close to crowded, not reaching the margin of pileus, at first tinged violaceus-purple, at length cinnamon; stipe elongate, tapering from the base to the apex, 8-12 cm. long, 6-8 mm. thick above, twice as thick at the base, dry, stuffed, at first clothed by a very thin, white, evanescent sheath, then subfibrillose, at first distincly violaceous-purple at the apex, soon fading to pallid, rather slender, spores narrowly ellipsoid, smooth, 9-10 x 5-6 microns, pale-ochraceous under the microscope.”

Discussion:
There are several Telamonia which have vinaceous brown tones and conic to campanulate caps. They are often described as section Biformes or Saturnini. While I am unsure of the placement of this species, those interested in these sections might like to read Liimatainen, Kare, X. Carteret, B. Dima, et al “Cortinarius Section Bicolores and Section Saturnini, a Morphogenetic Overview of European and North American Species,” (2017)

ITS:
Sequence of SDA 393 (matches SDA 05B) are a 99.74% match (3 base pairs out of 1166) to FJ717530 (field identification of C.subpurpureus – barcode determined by Liimatainen as C.substriatus.).

SDA393 – 18444274 – Cortinarius substriatus – US – WA
AGGTGACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGGCCTTCCAGGTCTATGTTGCTTTTTCATTTACCCCAATGTATGTTAATAGAATGTTGTGCCTATAAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCTTCTCATTTCTGAGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTAAATGAGTTCAGCTCCTCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGCGTGATAACTATCTACGCTATTGAATGTGAGGGATGGTTCAGCTTTCTAACAGTCCTTGGACAACTTATCATTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTGCCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGGGATCAACCTTGCTTTTGCTTGGTGCACTTTCTGGTTCGATGGGTCAGCATCAATTTTGACTGTTGGAAAAAGGTCAAGGGAATGTGGCATCTTTGGATGTGTTTATAGCCCTTGGTCACATACAATGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTTAAACCACGTACG

Sequenced by Matt Gordon with support from the Daniel E. Stuntz Foundation.