Cortinarius oregonensis

Cortinarius oregonensis A.H. Sm. Contributions from the University of Michigan Herbarium 2: 9 (1939)

Cortinarius oregonensis is a relatively common mid to late-fall species in Washington and Oregon states. It was described by AH Smith from Oregon. Due to it’s viscidity and distinctive coloration, it is relatively easy to identify and is a good beginner species for those learning Cortinarius ID. I would put it in the Top Ten Beginner Corts for our region.

Description

Pileus: 12-40mm (72 mm) wide, convex to near plane, viscid when wet, margin pale lilac-grey sometimes streaked with darker lilac fibrils (veil?), in age almost white, disc yellow to yellow-brown. Gills: At first violet or pallid then pallid, to yellow-brown. Stipe: 30-90 mm long, 4-10 mm (13 mm) thick at apex, clavate, lilac to lilac grey, lower stipe viscid, creamy white, with buff and brown patches in age. Cortina: pale lilac to white. Flesh: Taste: mild. Odor: Not distinctive. Habitat: Gregarious in mixed conifer forest, type description notes association with Spruce and several of our collections were in mixed Conifer forest with Spruce present.

Sequenced collections of Cortinarius oregonensis from WA State:

Discussion:

Cortinarius oregonensis is a slender and relatively small Cortinarius that is found in mature conifer forest in the Pacific Northwest (BC, Washington, Oregon and Northern California). It is characterized by a pale faintly-lilac viscid cap with yellow-brown disc, viscid clavate stipe and lilac young gills. It is in section Lustrati (see discussion of phylogeny, below).

One of our local collections was atypical (SDA670). It was significantly larger (up to 72 mm cap width) and had stronger, persistant purple tones in older fruitbodies. It is also interesting that the type description mentions that the stipe is “peronate with a bright violet fibrillose sheath which soon fades to violaceous white”. We have not observed this bright violet sheath in young specimens. Older collections may show very few lilac tones on stipe, gills or cap.

A good way to get practice identifying this species is to use iNaturalist to review other people’s observations and see if you agree with the ID. This photo links to additional collections including some from California. Some of these collections from California fit the description but appear to have a more pink rather than lilac or violet young gill color. It would be interesting to sequence some of these collections.

Phylogeny:

Soop et al. (2019) place C.oregonensis in /Lustrati along with Cortinarius leucophanes and Cortinarius comarostaphylidis. We have several species in our region, but the nomenclature is not yet clear and work is needed to clarify the relationship to Southern hemisphere and European species.

See phylogenetic tree in Soop et al. (2019) – page 267

With the exception of SDA670 the species discussed are all 100% or a very close match to Type (1 base pair or less, or only spacers that vary). SDA670 has slightly higher variabiton – with 2 base pairs difference – and as discussed above, is larger and more purple than other collections. It would be interesting to look at this collection in more detail.

TYPE Sequence: KF32366 – Holotype (A.H. Smith, Voucher AHS3557, 19th Nov. 1935, USA OR, Florence, Lake Tahkenitch)

>KF732366.1 Cortinarius oregonensis voucher MICH:10387 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence TTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGAGTTGCTGCTGACTCTTCTTGGGAAGAGTATGTGCACACTTGTCATCTTTATATCTCCACCTTTGTGCACCTTTTGTAGGCCTGTATATCTTTCTGAGTTGTTAGTGACTCAGGTTTGAGGATTGATTTTAAATAATCTTTCTTTACATTTGCAGGCCTATGTTTCATATACCCCATTGTATGTTTTAGAATGTAATAAACGGGCCTTTGTGCCTATAAACATTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCACCTTTGGCTTGTTGAGTGTTGGATGTGGGTTTGCTGGTTTCTCTCTTTTGAGGTCAGCTCTCCTGAAATGCATTAGCTGAACAATTTGTGGACCTTGTTCATTGGTGTGATAATTATCTACGCTATTGACAACAAAGCAAGCTCAGCTTCTAATAGTCCATTACTTGGACAATGTTTATATCAATGTGACCTCAAATCAGGTAGGACTACC CGCTGAACTTAAGCATATCAATAAGCGGA

References:

A.H. Smith (1939) Studies in the Genus Cortinarius I, Contributions from the University of Michigan Herbarium 2: 9

Liimatainen, K., T. Niskanen, B. Dima, I. Kytövuori, J.F. Ammirati, and T.G. Frøslev. “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era.” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (December 2014): 98–140. https://doi.org/10.3767/003158514X684681.

Soop, K., B. Dima, J.A. Cooper, D. Park, and B. Oertel. “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius ( Agaricales ) with an Emphasis on the Southern Mycota.” Persoonia – Molecular Phylogeny and Evolution of Fungi 42, no. 1 (July 19, 2019): 261–90. https://doi.org/10.3767/persoonia.2019.42.10.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

<span>%d</span> bloggers like this: