Cortinarius talimultiformis

Cortinarius talimultiformis Kytöv., Liimat., Niskanen, A.F.S. Taylor & Sesli (2014)

Description

Pileus 40-120 mm across, convex to plan, slightly viscid, hygrophanous (dark ochre to yellow, with yellow and yellow-brown spots). Lamellae: White to pale grey when young, to grey-brown. Stipe: bulbous, 40-110mm long, 10+ mm at apex, 20mm wide in bulb, white to yellow-brown. Flesh: White. Cortina: White, sometimes visible on pileus margin. Odor: Faintly sweet or honey odor. Spores: Average 8.8-9.9 microns x 5.3-5.6 microns. Strongly verrucose.

Photograph

NS1825 – Quartz Creek, Coopers Landing, Kenai, AK – August 2 Copyright: Noah Siegel.
Cortinarius talimultiformis. Copyright Noah Siegel. AK Collections

Discussion

Cortinarius talimultiformis is fairly typical of /Multiformes in the yellow-brown cap, relatively squat stature, white to grey-white young gills and white context. The species in this section are easy to recognize as a group but hard to differentiate to species. The description notes that fibrils on the pileus and margin are typical of this species, but I have observed fibrils on the margins of C.multiformis collections so am not yet clear how to use this feature in differentiation. While the type description differentiates Cortinarius talus (deciduous forest) from Cortinarius talimultiformes (Picea and Abies) on the basis of habitat, in our region Cortinarius talus is found in conifer forest too.

Phylogeny

Section Multiformes from Liimatainen et al (2014)

Type Reference sequence: NR_130306.1 (Sweden)

>NS1825 Cortinarius talimultiformis
AAGGATCATTATTGAAATAAACTGACAGGTTGTTGCTGGTTCTCTAGGGAACATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATATCTCTCTGAGTGCTTGCGCTCAGGTTTGAGGATTGATTCTTTTGTCTCTCCTTACATTTCCAGGCCTATGTTTCTTCATATACCCTAATGTATGTTATAGAATGTAATAAATGGGCCTTTGTGCCTATAAACATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATAATCAACCTCTTCAGCTTTTGCTTGTTGGGTGTTGGATGTGGGGGTACTTTTTGCTGGCCTCCCTGAGGTCAGCTCCCCTGAAATGTATTAGCGGAATAATTTGTGGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAATTCTGCTTCTAACAGTCCATTGACTTGGACAAATTTCATTAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

References

K. Liimatainen et al., “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era,” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (December 2014): 98–140, https://doi.org/10.3767/003158514X684681.

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑