Cortinarius microspermus

Cortinarius microspermus J.E. Lange, Flora Agaricina Danica 5: iii (1940) [MB#271088]

Description:
Cap 35 – 50 mm wide, pileus tawny yellow to red-brown on the disc, margin cream to white, viscid, gills pale clay-colored then milky-coffee to light ochre, stipe 30 – 80 mm long, 8 – 15 mm at apex, white or creamy-yellow with white outer layer, clavate, flesh white to off-white or cream taste bitter.

A rough measurement of spores from my NAm collection shows small spores, but some larger than the type suggests.

Spores are small (microspermus means small spore), much smaller than most Cortinarius species. They are described as 5 x 3 microns by Lange and 3 – 4 x 4 -5 by Orton. My collections were 5-6.5 x 3-4 microns. More measurements and collections will be needed to check establish a mean in NAm collections and to check if this is significant for the species concept.

Lange’s illustration of Cortinarius microspermus from Flora agaricina danica. Vol. 5

Discussion
Cortinarius collectors in the PNW will be familiar with slight, orange to cream Cortinarius with bitter viscid caps. Often found growing from coastal to montane elevation in thick moss we used to call all of these Cortinarius vibratilis or Cortinarius vibratilis group (group in this case being shorthand for uncertainty). Since hearing that some local collections have been sequenced as Cortinarius causticus, some have been using that name. However, we lack points of differentiation and the morphology is unclear.

Species in section Vibratiles from Cortinarius Flora Photographica Volume 5 (Brandrud et al 2012, 2018) showing the features of the section which, along with bitterness, will help keep feelings of despair at bay during field identification

Soop’s recent article on Supraspecific Taxonomy showed that there are many species in a broader group called section Vibratiles. Preliminary analysis of my sequences and those analyzed and compiled by Harrower (2011) suggest we have several undescribed species in our area and it is worth collecting and examing these small bitter Corts in more detail. Work will be needed to confirm which of the EU species occur in our region and which novel species remain to be identified.

Cortinarius microspermus placed in sect. Vibratiles from Soop et al 2019
Cortinarius species in section Vibratiles (Merlot) 91%Region
melleomitisSAm, NZ
(gemmeusNZ)
electridius ined.NZ
psilomorphusNZ
causticus IINAm
causticusEur, NAm
vibratilisEur, NAm
(decumbensEur)
(emollitusEur)
(galeobdolonEur)
(ochroleucusEur)
alboamarescensEur
barbatusEur
croceocoeruleusEur
emollitoidesEur
microspermusEur
ochroamarusEur
pluviorumEur
pluviusEur
Soop et al (2019) provide a preliminary listing of species in this section. Note that putative taxa that were not sampled for recent studies are listed in parentheses; these are taxa that have been described as (likely) members of the section but are not confirmed.

ITS
Matches 100% to UDB36990 from Norway, collected by Brandrud and 99.69% 638/639 base pairs (1 gap) for MG674293.1 another specimen from Norway. Using the UNITE species hypothesis SH1503949.

>SDA487 Cortinarius microspermus WA
GGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGAGTTGTTGCTGGTTCTCCAGGGAACATTGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATATCTCTCTAAGCGCTTGCGCTTGGGTTTGAGGATTGATTTCATTGTCTTTTCCTTACATTTCTAGGCCTATGTTTCTTCATATACCCCAATGTATGTTATAGAATGTAATAAAATGGGTCTTTATGACCTAATAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTACAGCTTTTGCTTGTTTGAGTGTTGGATGTGGGGGTTTATTTTTTGCTGGCCTTTCTGAGGTCAGCTCCCCTGAAATTCATTAGCGGAACAATTTGTTAACCGTTCATTGGTGTGATAACTATCTACGCTATTGATGGAAACAGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTTATTATTAATGTGACCTCAA

References:

Brandrud, T.E., Lindstroem, H et al. Cortinarius Flora Photographica vol.5 2012, (English) 2018

Harrower et al., “Cortinarius Species Diversity in British Columbia and Molecular Phylogenetic Comparison with European Specimen Sequences.” Botany, Vol. 89, 2011

Lange, J.E., Flora Agaricina Danica, Vol 5, Copenhagen 1935

Soop et al., “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius ( Agaricales ) with an Emphasis on the Southern Mycota.” Persoonia, Vol. 42, 2019

3 thoughts on “Cortinarius microspermus”

Add yours

  1. I totally agree for this group of butterscotch-cap bitter species it is impossible to rely their ITS sequence with morphology. DNA is very helpfull, but it just help, not more…

    Sorry if my English messages are not always very clear. As it’s me who didn’t understood well your text on C. alboviolaceus recently. You were very clear. In fact, I just wan’t to specify we have in the East a species fitting with European recent species concept when looking ITS data. And also other similar species, as C. acutispissipes. But the good one seems to be associated only with Birch, of course on both continents. We have also the bulbous C. lilacinus Peck with Oak and another seemingly unnamed (and unknown) species, so four white-violet ones in sct. Firmiores.

    English texts are never perfectly clear to me except when those are only very technical. Best, Yves.

    Liked by 1 person

  2. I appreciate your comments so will try to be clear. This appears to be a perfect match (DNA) to C.microspermus, but from my first 10 measurements of spores on one collection the spore size seems a bit larger, by approximately 1 micron in length. We will need more work on morphology, ecology and DNA to confirm species.

    I am interested to learn more about your species in sect. Firmiores. I had hoped to attend NEMF this year and see some of the Quebec species, but it is not looking as if we will be able to gather.

    C. acutispissipes is new to me. I must read up on it. For now, I am using Quarantine to write up one species per day. Today, it is C.collinitis which seems like another confusion.

    Like

    1. Your text on sct. Vibratiles honed-cap colored was clear to me. Thanks adding infos. Still work to do with those in Québec also!

      Concerning NEMF 2020, it has already been cancelled (source: people in charge).

      Cortinarius acutispissipes:
      You can go on Mycoquebec.org at this URL and there is a description and a few photos identified by ITS:
      https://www.mycoquebec.org/cardex.php?l=l&trie=C
      THEN CLICK ON LETTER C and all our Cortinarius in photos are listed, mostly all species have also a description, based modern re-description when possible, and sometimes annotated in “Remarques” when Québec collections differ from the European or American West Coast type.

      Best, Yves

      Liked by 1 person

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑