Cortinarius alboviolaceus (group)

Cortinarius alboviolaceus (Pers.) Fr., Epicrisis Systematis Mycologici: 280 (1838) [MB#199674]

Description:
Cap 20 – 70 mm wide, viscid to dry, convex to plane with undulating margin, color variable ranging from silvery white to grey to lavender-gray, tan to yellow-ochre center common in mature specimens, cap margin slightly upturned and thin appearing paler than cap, covered in white veil which gives it a silky appearance, joining cap to stipe in young specimens, in older, leaving a ‘boot’ of veil material on the lower stipe. Stipe 40 – 115 mm tall, 8 – 12 mm wide at apex, clavate, often showing swollen base, silky, covered in white to silvery grey fibers, sometimes lilac at stipe apex, gills close, lilac-grey at first later cinnamon or vinaceous-brown flesh purple, lilac grey, grey or cream, paler in base, often mottled or streaked with cream, odor nil, taste mild habitat in PNW this is a conifer forest species but occurs with Betula in EU.

NS31 Sequence by Dimitar Bojantchev confirmed C.alboviolaceus
NS22 Sequenced by Dimitar confirming C.alboviolaceus

Discussion:
For a distinctive species Cortinarius alboviolaceus can take some nerve to identify due to the wide variability within the species. It can vary in size, color, thickness of veil, viscidity and even cap texture. In Europe it occurs in hardwood forests, but in the PNW it is common in our conifer forests. It is often gregarious or scattered. It may be confused with Cortinarius camphoratus but that can be differentiated by the strong odor of rotting potato and different purple tone.

This species aligns with sequences assigned to the Cortinarius alboviolaceus group in publications (see below) but a clear type for the species has not been published. According to Dimitar Botjantchev, who has sequenced many North American collections of Cortinarius alboviolaceus, he has found our West Coast collections to match the one concept which also occurs in the EU, hence the name. My collection SDA 554 (featured photo), NS22 and NS31 all match the same concept. However, it appears that there may be other species in the Cortinarius alboviolaceus group, as noted in the work of Garrido-Benavent (2019) where several clusters are visible. In this analysis, my US collections map to FJ157005. Hopefully, future work and neotype will clarify which are a match to the Type concept and if there are several ‘alboviolaceus’ species in this group.

Source: Garrido-Benavent et al . Cortinarius Uxorum paper (2019)

ITS:
>SDA_554
AAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTTCTAGGTCTATGTTGCTTTTTCATTTACCCCAATGTATGTTAATAGAATGTTGTGACTATAAAAACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATCAACCTTCTCATTGCTGAGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTAAATGAGTTCAGCTCTCCTGAAATGCATTAGCAGAACAACCCTGTTCATTGGCGTGATAACTATCTACGCTATTGAATGTGAGGGACAGTTCAGCTTTCTAATAGTCCTTGGACAACTCATCATTTATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGA

References:
Garrido-Benavent, Issac, Ballara, Josep, and Mahiques, Rafael, “Cortinarius Uxorum, a New Telamonioid Species in Cortinarius Sect. Firmiores from the Iberian Peninsula”, Phytotaxa, 403 (3) 2019

3 thoughts on “Cortinarius alboviolaceus (group)”

Add yours

  1. Collections without Betula nearby (neither present in the area) have really been confirmed by ITS sequence to be C. alboviolaceus ss. str.?

    Like

    1. Hi,
      No, apologies if that was not clear. I do not have a confirmed type sequence to define C.alboviolaceus ss. str. which is why I consider this a group until proven otherwise. If someone has established the type, I have not seen it published.

      The closest I have is the species concepts on UNITE where there are 6 concepts. The largest has 59 collections (the largest group by far) and reference sequence chosen by Ursula Peinter AF325596. My collections match this 99.69% (2 bases off). There are collections from Sweden, USA and Canada.

      Dimitar ran a very rough tree which shows the groups represented on Genbank and Noah’s. There were slight genetic differences so more work is needed on morphology and ecology. He has found all our West Coast collections appear the same species. On his analysis of Genbank data Renee’s MH910586 groups differently(https://mushroomobserver.org/observer/show_observation/247419).

      I ran my conifer collection against a German collection in the UNITE Species hypothesis that noted “betula pendula” and it was only 97.7% like.

      So, work remains to be done and I call this a group with EU and NAm species, until things are clarified.
      Best,
      Shannon

      Like

      1. I just beleive that if a neotype is designed, it should be a Birch associated species. Jacques Landry could add more infos if he wants to.
        Thanks!

        Like

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑