Cortinarius caesiifolius

Cortinarius caesiifolius A.H. Sm. (1939)
Section anomali
Collected by: Steve Trudell, Shannon Adams
Coll #: SAT-13-298-15, SDA 671, SDA 648
Photograph: Steve Trudell
Location: Mixed conifer forest, HJ Andrews Experimental Forest, Oregon and WA State

SDA 671 WA State

Notes: This is a relatively common and fairly distinctive PNW member of Section Anomali. An upcoming paper will stabilize the names in this section. The three collections here vary by 2 base pairs in a way that looks like a read interpretation (3 vs 4 bases repeated). North American species in section Anomali include at least 9 species:

  • Cortinarius anomelovelatus
  • Cortinarius anomalus
  • Cortinarius barlowensis
  • Cortinarius caninus
  • Cortinarius sericeolazulinus
  • And several undescribed species

ITS

Type: USA, Washington, Olympic National Park, Olympic Hot Springs, 19 Oct 1935, A. H. Smith, AHS3227 (holotype MICH 10326). GenBank ITS: MZ580462.

This collection is 99.5% similar to the type with one base pair of difference and 2 gaps.

>SDA_648
GGAAGGATCATTATTGAAATAAACCTGATGGGTTGCTGCTGGTTTTTTAATGAACATGTGCACATCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACATGGACAAAGTTTCTTAATGCTAGCATTAAGGTTTTGGGATTGACTTTTGTCTCTCCTTATATTTCCAGGTCTATGTTTATTCATATACCCTAATGTATGTTAAAGAATGTAATAAAATGGGCCTTTGTGTCTATAACACTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGCTGGATGTGGGGGGCCTTTTTGCTGGTCTTTTAAAGAGATCAGCTCCCCTAAAATGTATTAGCGGAACAATTTGTTGACCATTCATTAGTGTGATAATTATCTACGCTATTGACGTGAGACAGTTCAGCTTCTAACAGTCCATTGACTTGGACAATTCTTCATTAAT

References

Dima, B., Liimatainen, K., Niskanen, T. et al. Type studies and fourteen new North American species of Cortinarius section Anomali reveal high continental species diversity. Mycol Progress 20, 1399–1439 (2021). https://doi.org/10.1007/s11557-021-01738-0

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑