Cortinarius distortus

Cortinarius laniger Fr., Epicrisis Systematis Mycologici: 292 (1838)

The ITS region is the standard for Cortinarius phylogeny and species deliniation. However, there are known areas where species that appear morphologically distinct show slight ITS variation – below the typically accepted threshold of 99% (established in Garnica et al 2016). The case of Cortinarius laniger, solis-occasus and distortus is one in which the barcode is not the final source of truth.

In this case, my collection matches the TYPE for Cortinarius distortus exactly. However, it is only one base different from several other proposed species. After reviewing Kauffman’s description of Cortinarius distortus I am confident that this species (not related ones) are reflected in his text in American Flora (1932) but encourage you to read the sources yourself.

Cortinarius distortus:
Description:
Cap 30 – 70 mm wide, hemispherical when young, slightly umbonate to convex, rarely plane, caps often a perfect circle, surface dry, finely fibrillose, salmon-ochre when young, fading when dry to tan or light brown cortina white, abundant, covers cap in young specimens, gills are a distinctive apricot-salmon pinkish-orange, starting out brighter then becoming more rusty-brown but never dull, stipe 30 – 80 mm long, 8-20 mm wide at apex, cylindrical to clavate at base, light cinnamon brown covered in white veil material with a distinct annular zone on the stipe with thicker material, flesh solid but fragile, mottled brown and cream, sometimes rusty brown and cream. Habitat: montane coniferous forest.

SDA 010 Cortinarius distortus from British Columbia showing the distinctive pinkish-red gills

ITS Analysis

I am following Liimatainen et al 2020 in differentiating Cortinarius laniger and Cortinarius distortus in section Lanigeri (both occuring in WA state). I provide sequences of two collections but as can be seen from Liimatainen et al (2020) species delineation on ITS is very subtle. If you compare with a the morphology the distinction is apparent.

>Cortinarius distortus SDA_548 – WA, USA
AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGAYGGGTTGTTGCTGGTTCCCTAGGGAGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGGCCTTTCAGGTCTATGTTGCTTCATTTACCCCAATGTATGTTAATAGAATGTTGTGACTATAATATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATATATCAAACCCTCTCTTGTCGAGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTGAAGGGTTCAGCTCCTCTGAAATGCATTAGCAGAACAACAACCTGTTCATTGGTGTGATAACTATCTACGCTATTGAATGTGAGGGTAAAAGTTCAGCTTTCTAACCGTCCATGGACAATTTATCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTATGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTG

>SDA 010 Cortinarius distortus – BC, Canada TACCTGATTTGAGGTCACATTAATGATAAATTGTCCATGGACGGTTAGAAAGCTGAACTTTTACCCTCACATTCAATAGCGTAGATAGTTATCACACCAATGAACAGGTTGTTGTTCTGCTAATGCATTTCAGAGGAGCTGAACCCTTCAAGAGGCCAGCAAACCCCCACATCCAAACCACTCGACAAGAGAGGGTTTGATATATATATTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGATATTATAGTCACAACATTCTATTAACATACATTGGGGTAAATGAAGCAACATAGACCTGAAAGGCCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACAAGGTGTGCACATGCTCCCTAGGGAACCAGCAACAACCCGTCAGGTTTATTTCAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTC

Many species names have been given to fungi with identical ITS regions (above). The proposed species delineation is based on morphology and 1 base pair of ITS variation and includes C.laniger and C.distortus. However, Niskanen 2012 suggests that C.solis occasus may also be a valid name due to distinct morphology.

From an alignment of our local species it seems we have Cortinarius distortus, but the trace files and results from related collections such as SDA 632 Cortinarius aff laniger, need further research. The alignment of the barcodes of these species with Types show the subtle variation

Barcode alignment (above) with morphological comparison (Below) – on LEFT: Cortinarius aff laniger (SDA 632), on RIGHT Cortinarius distortus (SDA 548)

Discussion

In the PNW, large Telamonia s.l that are without violet colors and with vivid rust-colored gills have been called Cortinarius laniger group. The recent publication of a major work into subgenus Telamonia provides more guidance for naming these species.

Reviewing the EU descriptions of the veil of solis occasus is described as having a grey-lilac veil as distinct from the white cortina and lilac tones at stipe apex. They note that Cortinarius laniger lacks lilac tones. Lilac is not observed on any of our PNW collections. I am also unsure on whether the darker brick red collections that are otherwise similar are the same species and need to do some work to compare.

Kauffman’s description of C.distortus is a strong match to these PNW collections:

References:

Garnica, Sigisfredo, Max Emil Schon, and Kessy Abarenkov. “Determining Threshold Values for Barcoding Fungi: Lessons from Cortinarius (Basidiomycota), a Highly Diverse and Widespread Ectomycorrhizal Genus.” FEMS Microbiology Ecology 92, no. 4 (2016).

Kare Liimatainen et al., “Mission Impossible Completed: Unlocking the Nomenclature of the Largest and Most Complicated Subgenus of Cortinarius, Telamonia,” Fungal Diversity, September 8, 2020, https://doi.org/10.1007/s13225-020-00459-1.

Kauffman, North American Flora, 10 (5), pp 321-2, New York Botanical Garden, 1914

Mycoquebec, 2020: Cortinarius laniger and Cortinarius solis occasus. http://www.mycoquebec.org

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

%d bloggers like this: