Cortinarius subminiatopus

Cortinarius subminiatopus Kytöv., Niskanen & Liimat., Index Fungorum 344: 3 (2017)

Description:
Cap 6 – 25 mm wide, conical to sub-umbonate, smooth, silky, coffee brown on disc to salmon pink on margin, cortina orange-pink to scarlet on cap margin and lower stipe, most vivid on button but present on all specimens, gills pinkish-orange to cinnamon, stipe 16 – 38 mm long, 2 – 4 mm wide at apex, equal to sub-clavate, cream, covered in orange-pink to scarlet veil.

Discussion:
I have seen this species twice in 2019, weeks apart. Once in the Northern WA Cascades and once in the Southern Cascades. On both occasions it was in deep moss in conifer forest at some elevation. Despite the small size, it stands out due to the unusual coloration and silky texture.

At first, I called the species Cortinarius colus but the barcode matches to Cortinarius subminiatopus on Genbank based on 563/564 base pairs. Authors of Cortinarius Flora Photographica propose that Cortinarius miniatopus (Lange) is a synonym for Cortinarius colus – the latter being the correct name. However, Cortinariologists in France dispute this synonymy. I have yet to clarify whether Cortinarius colus and subminiatopus are synonyms, there appears a very close relationship based on ITS records on Genbank. We look to upcoming work on Telamonia types to settle this debate.

Cortinarius miniatopus, colus and subminiatopus are Telamonia sensu strictu, in section Anthracini. Sect. Anthracini is known for small, slender fruitbodies, orange or red universal veil, anthraquinoid pigments and hygrophanous caps.

ITS:
The species is 1 base pair different from Cortinarius subminiatopus from Type published on Genbank (NR_154867, ). There is an additional base that was ambiguous but consistent in both. Since I have not yet found a confirmed Type reference for C.colus, and relatively small ITS variations are sometimes used to differentiate species, it is conceivable that this is A different species in the section, a possibility I will continue to investigate.
>SDA_569
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATGGGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACGCCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCCTTCCAGGTCTATGTTGCTTCATTTACCCCCAATGCATGTTAATAGAATGTTGTGCCTGTAAAATAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATCTATATCAACCTTCTCTTGTAGAGTGTGGTTTGGATGTGGGGGTTTGCTGGCCTCTTTRAAGGTGTCAGCTCCCCTGAAATGCATTAGCGGAACAACCTCGTTCATTGGTGTGATAACTATCTACGCTATTGGATGTGAGGGACAGTTCAGCCGTCTAACAGTCCTCGGACAATTTATCATCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACG

Bibliography

Bendiksen, K, and T E Brandrud. “Cortinarius Flora Photographica Vol 1-5