Cortinarius causticus

Cortinarius causticus Fr., Epicrisis Systematis Mycologici: 270 (1838)

Description:
Pileus: 26-40 mm across, tawny, to ochraceous-tawny to light tan, zonate colors, darker on disc, convex, margin at first incurved, later straight, mature margin pale relative to disc, viscid to dry, sometimes sticky, bitter taste on both cap and stipe. Lamellae: White, to cream, later light cinnamon brown, milky coffee or yellow-brown. Stipe: 35-70 mm long, 3-6 mm across at apex, slender, fragile, clavate to ventricose, viscid, surface cream to white, white sheath on lower parts with upper margin of often marked by cinnamon spore deposits, bruises yellow with handling. Context: Pale yellow center with creamy-white margins. Taste: Bitter

Discussion:
Cortinarius causticus can be recognized by the viscid ochraceous-tawny cap with bitter cuticle, small stature with relatively long, slender, sheathed stipe and yellow context. The original type description by Fries mentions the hygrophanous cap, yellow flesh, and smooth white sheath. He compares it to the Telamonia Cortinarius armeniacus (which is not viscid).

• 

• 

• 

• 

• 

• 

Further examples of sequenced collections can be seen on the Mycoquebec website here.

Phylogeny:
Cortinarius causticus is in /Vibratiles (Melot). There is no confirmed Type sequence of Cortinarius causticus on Genbank and there are many undescribed species. However, published papers have used reference sequences for the species concept (Garnica et al., 2016) and Soop (2019). A rough phylogenetic tree of local sequences in /Vibratiles shows that this is the most common species, matching GQ159868 which was identified as Cortinarius causticus in Garnica et. al. (2016). It is the same species as represented by Cortinarius causticus NAm II (UBC F17125 = GQ159868) on Soop’s phylogeny and My records show that at least 6 species occur in the Pacific Northwest.

>ITS: SDA667
GCGGAAGGATCATTATTGAAATAAACCTGATGAGTTGTTGCTGGTTCTCTCTCCAGGGAATATTGTGCACACTTGTCATCTTTATATCACCACCTGTGCACTTTTTTTGTAGGCGAGGATTAACTTCCAAGTCTATGTTTCTTCATATACCCTAATGTATGTTATAGAATGTAAATGTAATGGGCCTTTGTTGCCTATAAAACTTTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCACTTGTTGAGTGCTTGGATGTGGGGGTTTTGCTGGACTCTTTTGAGGTCAGCTCCCTTGAAATRCATTAGCAGAACAAATCCGTTCATTTTGGTGTGATAAACTATCTACGCTAATTGACCAAGTTCAGCTTCTAACAGTCTTTATTGACAATTTTTTATTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAGT

References

Garnica, Sigisfredo, Max Emil Schon, and Kessy Abarenkov. “Determining Threshold Values for Barcoding Fungi: Lessons from Cortinarius (Basidiomycota), a Highly Diverse and Widespread Ectomycorrhizal Genus.” FEMS Microbiology Ecology 92, no. 4 (2016).

Soop, K., B. Dima, J.A. Cooper, D. Park, and B. Oertel. “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius ( Agaricales ) with an Emphasis on the Southern Mycota.” Persoonia – Molecular Phylogeny and Evolution of Fungi 42, no. 1 (July 19, 2019): 261–90. https://doi.org/10.3767/persoonia.2019.42.10.

Credit:
With thanks to the Puget Sound Mycological Society and NAMA for funding the sequencing of the NAMA collections from the 2014 PNW Foray. Also, to the Continental Mycoflora Project for sequencing two of my collections as part of the 2019 Mycoblitz.