Cortinarius putorius

Niskanen, Liimat. & Ammirati, Fungal diversity 75: 222 (2015)

Description:
Cap: 30-90mm wide, broadly convex to plane, pale purple-lilac when young, to almost white, viscid in moist conditions. Gills: purple when young, becoming dark purple to dark brown. Stipe: 50-130mm long, 6-10mm at stipe apex, clavate to equal, pale purple to whitish covered with abundant silky fibrils, marking purple when handled Universal veil: white. Context: Purple when young, then pale lavendar to grey becoming strong yellowish brown from lower half of stipe.

Discussion:
Cortinarius putorius is in section Camphorati a section which is known for purple to white fruitbodies with unpleasant odor and distinct cheilocystidia (which is unusual for Cortinarius).

It’s name refers to its unpleasant smell (derived from the latin word “putorius” which means “fetid odor”). You may be familiar with Cortinarius camphoratus which is a more common species in the Pacific Northwest. Cortinarius camphoratus is also characterized by a strong, unpleasant odor.

Cortinarius putorius is said to differ from C.camphoratus in being more purple (vs white) when young, having white cortina fibrils (vs lilac) and having smaller spores. In practice, I have not always been able to detect lilac in the cortina of Cortinarius camphoratus so this might not provide an easy point of differentiation for the non-expert. However, the description and the few photographed collections that are available do show Cortinarius putorius as more purple and with a more slender stipe than Cortinarius camphoratus:

  • The purple tones in Cortinarius putorius seem stronger throughout, particularly in the young gills, while Cortinarius camphoratus has a more lavendar young gill tone and does not show the “strong brown” gill color in mature specimens.
  • The described diameter of C.putorius‘s stipe is 6-10mm at apex and 6-12mm at base. By contrast, Cortinarius camphoratus is typically 10-20mm wide at stipe apex and I have some collections where the stipe apex measures close to 30mm.

Microscopy could also provide some diagnostics if you are willing to take a number of measurements across several specimens. The spores of Cortinarius putorius are smaller on average:
– C.putorius: 8.8-9.5(-10) x 5-5.7 Average 9.2 x 5.4 microns
– C.camphoratus: (9-) 9.5-10.5 x (5.5-)6-6.5

Phylogenetics

Source: Soop et al (2019)

Sequence:
The photographed collection is a 100% match to NR_153038.1 which is from Type material.

>NS4672 Cortinarius putorius
GAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATAAACCTGATAGGTTGCTGCTGGTTTCTCTAAGGAACATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTCTTGTAGACCTGGATCTTTTTCTGAATATTATTATTCAGGTTTGAGGATTGACTCTTCTGTCTCTCCTTATATTTCCAGGCCTACGTTTTCTTCATATATATACCCCAATGTATGTTATAGAATGTAATAAATGGGCCTTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACTTCTTCAACTTTTGCTTGTCGAGTGTTGGATGTGGGGGTTATTTTTTGCCGGGTCTCTTTTAATTGAGGTCGGCTCCCCTGAAATGCATTAGCGGAACAATTTGTTGACCGTTCATTGGTGTGATAAACTATCTACGCTATTGACGTGAGCCAGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGTCAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGC

References:

Liimatainen et al in Hiran Ariyawansa et al., “Fungal Diversity Notes 111–252—Taxonomic and Phylogenetic Contributions to Fungal Taxa,” Fungal Diversity 75 (November 6, 2015): 27–274

K. Soop et al., “A Phylogenetic Approach to a Global Supraspecific Taxonomy of Cortinarius (Agaricales) with an Emphasis on the Southern Mycota,” Persoonia – Molecular Phylogeny and Evolution of Fungi, 2019

One thought on “Cortinarius putorius”

Add yours

  1. Hey! This is my first visit to your blog! We are a collection of volunteers and starting a new project in a community in the same niche. Your blog provided us valuable information to work on. You have done a wonderful job!

    Like

Leave a comment

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑