Cortinarius pallidifolius

Cortinarius pallidifolius A.H. Sm. (1939) [MB#253771]

Description:
Cap 42- 90 mm across, umbonate to plane to upturned, with persistent umbo, heavily glutinous, tawny-ochre, then yellow-ochre on margin, tawny- ochre on disc, cortina white under thick gelatinous, yellow-brown veil, gills off-white to buff, becoming cinnamon brown, stipe 58 – 83 mm long, 8-10 mm thick at apex, clavate, covered with glutinous yellow-brown veil, forming brown chevrons on lower half, flesh white, taste unpleasant, KOH olivaceus brown.

Discussion:
When I first had the results from this species I noted it as a match to C.cephalixus which turns out to be a synonym for C.cliduchus. However, those species vary from C.pallidifolius both in 4-6 base pairs / gaps and in being deciduous vs conifer forest species.

Liimatainen et al (2014) place C.pallidifolius in Section Elastici & Percomes sensu latu. It is grouped with C.pseudocephalixus from France, from which it has a small but significant difference.

ITS:
This is a very close match to C.pallidifolius MICH Type (KF732370.1) which was published in the Liimatainen (2014) type study. However, it is not as perfect as most of the species I publish. The type sequence on Genbank is 634 pairs long with 4 base pairs different. All four are spaces – where one of the barcodes has a gap vs a base, and it seems likely it the same species.

>SDA381-18455683 Cortinarius pallidifolius- US – WA
TAGGTGACCTGCGGAAGGATCATTATTGAAATAAATCTGATGAGTTGCTGCTGGTTCTCTTGGGAGCATGTGCACGCTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACTTGGATATCTCTCTGAGTGCTAGTCACTCGGGTTTGGGGATTGACTTTACGTCTATTCTTACATTTCCAGGCCTATGTTTCTTCATATACCCCAATTGTATGTTATAGAATGTAATCAATGGCCTCTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGTTGGATGTGGGGGGT:CTTTTTGCTGGT:CTTTTCAAGGTCAGCTCCCTGAAATGTATTAGCGGAACAATTGTGGACCGTTCATTGGTGTGATAACTATCTACGCTATCGACGTCAAGCAGTTCAGCTTCTAACAGTCCATTGACTTGGACAAATTTCATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGTCAGTCTTTGACTGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTCTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGGGATCAACCTTGCTTTTGCTTGGTGTACTTTCTGGTTGACGGGTCAGCATCAATTTTGACTGTTGGAAAAAGGTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCCTTGGTTGCATACAATGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTATTAACCACGTACGT

Bibliography
Liimatainen, K., T. Niskanen, B. Dima, I. Kytövuori, J.F. Ammirati, and T.G. Frøslev. “The Largest Type Study of Agaricales Species to Date: Bringing Identification and Nomenclature of Phlegmacium (Cortinarius) into the DNA Era.” Persoonia : Molecular Phylogeny and Evolution of Fungi 33 (December 2014): 98–140. https://doi.org/10.3767/003158514X684681.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s

This site uses Akismet to reduce spam. Learn how your comment data is processed.

A WordPress.com Website.

Up ↑

%d bloggers like this: