Cortinarius pini

Cortinarius pini Brandrud, Edinburgh Journal of Botany 53: 360 (1996)

Description:
Cap 15-55 mm across, thinly viscid, to dry with adhering debris, yellow-brown with paler margin (cinnamon rufous to cinnamon buff), hygrophanous blotches and streaks towards margin stipe 50-80 mm long, 7-11 mm thick at apex, sub-clavate, with pallid to cinnamon brown veil bands, gills pale lilac, becoming pallid to light brown, no odor, taste mild to slightly bitter, KOH cap, yellow ochre on flesh KOH yellow ochre on stipe and cool dark brown (“burnt umber”) Habitat mixed conifer forest.

Notes from Brandrud 1996 Type Description:
“Cortinarius pini is a fairly anonymous species but can be characterized by its greyish ochre, rivulose-micaceous pileus with a well-developed pellicle, pale lilac-grey lamellae, sparse veil and association with Pinus sylvestris. “

Comments:
I first collected this species in fall 2019. We have two photographed PNW collections (mine from Northern OR Cascades and Noah’s from Mt Rainier region). Neither occurred with Pinus sylvestris (which is not native to the PNW). These collections are a 100% match to a collection by Yves Lamoreaux from Southern Quebec (between Ottawa and Montreal) as well as a match to several BC Collections sequenced by Harrower et al in 2009.

The Quebec collection is much warmer yellow (vs grey-brown in the type description) and does not have the rivulose or hygrophanous blotches seen in both PNW collections. However, it does have the slightly corrugated margin described by Brandrud, which I did not see in our local collections.

ITS Analysis:
The PNW, BC and Quebec collections are a 99.6% match to the European Isotype NR_130244.1 from Norway collected in 1985 as well as a 100% match to several other EU collections. The variation from the type was only two gaps which were inconclusive (N) on our barcode. Given the similarity in appearance and the slight difference in phylogeny I consider these the same species.
>SDA 621 Cortinarius pini
TGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACCTGGATGTCTCTCTGAATGCTAGTCAGTCAGGTTTGAGGATTGACTTCTATGTCTCTCCTTACATTTCCAGGCCTATGTTTCTTCAATATACCCAATGTATGTCATAGAATGTAATCAATGGCCTTTTGTGCCTATAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTCTTCAGCTTTTGCTTGTTGAGTGTTGGATGTGGGGGTTTGCTTTGCTGGTCTTCTCAGATCAGCTCCCCTGAAATGCATTAGCGGAACAATTGTGGACCGTTCATTGGTGTGATAACTATCTACGCTATTGACGTGAAGCAGTTTAGCTTCTAACAGTCCATTGACTTGGACAAATTTTCATTAATGTGACCTCAAATCAGGT

Quebec sequence

Bibliography

Brandrud, T. E. “Cortinarius Subgenus Phlegmacium Section Phlegmacium in Europe: Descriptive Part.” Edinburgh Journal of Botany 53, no. 3 (November 1996): 331–400. https://doi.org/10.1017/S0960428600003772.

Harrower, Emma, Joseph F. Ammirati, Adam A. Cappuccino, Oldriska Ceska, J.M. Kranabetter, Paul Kroeger, SeaRa Lim, Terry Taylor, and Mary L. Berbee. “Cortinarius Species Diversity in British Columbia and Molecular Phylogenetic Comparison with European Specimen Sequences.” Botany 89, no. 11 (November 2011): 799–810. https://doi.org/10.1139/b11-065.